Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 1312648
End position: 1312677
Length: 30

DNA sequence
>NC_019689, from 1312648 to 1312677 (30 bp); Pleurocapsa sp. PCC 7327 GGCTTTGGCTGTCTTTCGCTGGTTTTGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1312646-1313545	Sequence	Ple7327_1235 - hypothetical protein (Protein is coded in complementary strand; from 1313545 to 1312646)