Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 52146
End position: 52173
Length: 28

DNA sequence
>NC_019689, from 52146 to 52173 (28 bp); Pleurocapsa sp. PCC 7327 TTGTCCTTTGTCATTTGTTCTTTGTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 51213-52160	Sequence	Ple7327_0045 - glycosyl transferase (Protein is coded in complementary strand; from 52160 to 51213)