Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 4868951
End position: 4868978
Length: 28

DNA sequence
>NC_019689, from 4868951 to 4868978 (28 bp); Pleurocapsa sp. PCC 7327 TTTGTCATTTGTCCTTGGTCATTGGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4868717-4868980	Sequence	Ple7327_4555 - hypothetical protein (Protein is coded in complementary strand; from 4868980 to 4868717)
ORF... 4868977-4869696	Sequence	Ple7327_4556 - iron-sulfur cluster biosynthesis transcriptional regulator SufR (Protein is coded in complementary strand; from 4869696 to 4868977)