Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 4420519
End position: 4420546
Length: 28

DNA sequence
>NC_019689, from 4420519 to 4420546 (28 bp); Pleurocapsa sp. PCC 7327 CTTCTGCCTTTTGCCTTCTGCCTTCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4418903-4420711	Sequence	Ple7327_4138 - Peptidase family M48 (Protein is coded in complementary strand; from 4420711 to 4418903)