Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 4282973
End position: 4283000
Length: 28

DNA sequence
>NC_019689, from 4282973 to 4283000 (28 bp); Pleurocapsa sp. PCC 7327 AATGACAAAGGACAAATGACAAAGGACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4282989-4283789	Sequence	Ple7327_4012 - dehydrogenase of unknown specificity, short-chain alcohol dehydrogenase like protein