Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 4246574
End position: 4246601
Length: 28

DNA sequence
>NC_019689, from 4246574 to 4246601 (28 bp); Pleurocapsa sp. PCC 7327 CCCTCTGCCTTCTGCCCTCTGCCTTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4246565-4247959	Sequence	Ple7327_3983 - nitrogenase molybdenum-iron cofactor biosynthesis protein NifE (Protein is coded in complementary strand; from 4247959 to 4246565)