Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 401729
End position: 401756
Length: 28

DNA sequence
>NC_019689, from 401729 to 401756 (28 bp); Pleurocapsa sp. PCC 7327 CCTTTGTTCTTTGTCATTTGTCCTTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 400208-401770	Sequence	Ple7327_0361 - acyl-CoA synthetase (AMP-forming)/AMP-acid ligase II (Protein is coded in complementary strand; from 401770 to 400208)