Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 3724623
End position: 3724650
Length: 28

DNA sequence
>NC_019689, from 3724623 to 3724650 (28 bp); Pleurocapsa sp. PCC 7327 ATGACCGATGACCGATGACCGATGACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3723630-3726908	Sequence	Ple7327_3470 - PAS domain S-box (Protein is coded in complementary strand; from 3726908 to 3723630)