Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 3721971
End position: 3721998
Length: 28

DNA sequence
>NC_019689, from 3721971 to 3721998 (28 bp); Pleurocapsa sp. PCC 7327 ACCAATGACCAATGACCGATGACCGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3720991-3723459	Sequence	Ple7327_3469 - signal transduction histidine kinase (Protein is coded in complementary strand; from 3723459 to 3720991)