Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 3672261
End position: 3672288
Length: 28

DNA sequence
>NC_019689, from 3672261 to 3672288 (28 bp); Pleurocapsa sp. PCC 7327 TTTGTCCTTTGTCGTTTTTCCTTTGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3669262-3673272	Sequence	Ple7327_3418 - magnesium chelatase, H subunit (Protein is coded in complementary strand; from 3673272 to 3669262)