Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 2899138
End position: 2899165
Length: 28

DNA sequence
>NC_019689, from 2899138 to 2899165 (28 bp); Pleurocapsa sp. PCC 7327 TACTAACCACTAACTACTGACTACTAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2899162-2899680	Sequence	Ple7327_2691 - adenine phosphoribosyltransferase (Protein is coded in complementary strand; from 2899680 to 2899162)