Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 2840598
End position: 2840625
Length: 28

DNA sequence
>NC_019689, from 2840598 to 2840625 (28 bp); Pleurocapsa sp. PCC 7327 TAACCACTAACCACCAACCACTAACTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2840623-2840724	Sequence	Ple7327_2632 - hypothetical protein (Protein is coded in complementary strand; from 2840724 to 2840623)