Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 2717039
End position: 2717066
Length: 28

DNA sequence
>NC_019689, from 2717039 to 2717066 (28 bp); Pleurocapsa sp. PCC 7327 AATGATTACTGATTACTGATTACTGATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2717045-2718262	Sequence	Ple7327_2518 - Zn-dependent protease (Protein is coded in complementary strand; from 2718262 to 2717045)