Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 2495624
End position: 2495651
Length: 28

DNA sequence
>NC_019689, from 2495624 to 2495651 (28 bp); Pleurocapsa sp. PCC 7327 TTCATAATTCACAATTCATCATTCAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2494973-2495629	Sequence	Ple7327_2316 - hypothetical protein (Protein is coded in complementary strand; from 2495629 to 2494973)