Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 2071567
End position: 2071594
Length: 28

DNA sequence
>NC_019689, from 2071567 to 2071594 (28 bp); Pleurocapsa sp. PCC 7327 GGTTAGTCGTTAGTGGTTACTGGTTAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2071584-2072312	Sequence	Ple7327_1934 - RNA methyltransferase, RsmE family (Protein is coded in complementary strand; from 2072312 to 2071584)