Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 1997903
End position: 1997930
Length: 28

DNA sequence
>NC_019689, from 1997903 to 1997930 (28 bp); Pleurocapsa sp. PCC 7327 CAAATGACCAATGACCAATGACCAATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1996928-1997917	Sequence	Ple7327_1858 - ABC-type multidrug transport system, ATPase component
ORF... 1997928-1998710	Sequence	Ple7327_1859 - ABC-type uncharacterized transport system, permease component