Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 1726717
End position: 1726744
Length: 28

DNA sequence
>NC_019689, from 1726717 to 1726744 (28 bp); Pleurocapsa sp. PCC 7327 TAATTGGTCATTGGTCATTGGTCATTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1725290-1726735	Sequence	Ple7327_1613 - SagB-type dehydrogenase domain protein (Protein is coded in complementary strand; from 1726735 to 1725290)