Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 1290788
End position: 1290815
Length: 28

DNA sequence
>NC_019689, from 1290788 to 1290815 (28 bp); Pleurocapsa sp. PCC 7327 AATCGCTAATTGCTAATCACTAATCACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1290808-1292865	Sequence	Ple7327_1215 - thioredoxin domain protein (Protein is coded in complementary strand; from 1292865 to 1290808)