Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 1063497
End position: 1063524
Length: 28

DNA sequence
>NC_019689, from 1063497 to 1063524 (28 bp); Pleurocapsa sp. PCC 7327 ATTGGTTGTTGGTTATTAGTTCTTGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1062750-1063499	Sequence	Ple7327_0994 - ABC-type branched-chain amino acid transport systems, ATPase component (Protein is coded in complementary strand; from 1063499 to 1062750)