Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 575902
End position: 575928
Length: 27

DNA sequence
>NC_019689, from 575902 to 575928 (27 bp); Pleurocapsa sp. PCC 7327 GGCAGAGAAGGCAGAGAAGGCAGAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 574489-576216	Sequence	Ple7327_0526 - TonB family protein (Protein is coded in complementary strand; from 576216 to 574489)