Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 3717567
End position: 3717593
Length: 27

DNA sequence
>NC_019689, from 3717567 to 3717593 (27 bp); Pleurocapsa sp. PCC 7327 TCAATCGCTTCGATCGCTTCAATCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3717390-3718301	Sequence	Ple7327_3465 - ABC-type phosphate/phosphonate transport system, periplasmic component