Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 1904514
End position: 1904540
Length: 27

DNA sequence
>NC_019689, from 1904514 to 1904540 (27 bp); Pleurocapsa sp. PCC 7327 CCGCCTTCACCGCCTTCACCGCCTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1904469-1904687	Sequence	Ple7327_1776 - hypothetical protein (Protein is coded in complementary strand; from 1904687 to 1904469)