Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 621564
End position: 621587
Length: 24

DNA sequence
>NC_019689, from 621564 to 621587 (24 bp); Pleurocapsa sp. PCC 7327 CCTCTGCGCCTCTGCGCCTCTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 621549-623357	Sequence	Ple7327_0576 - DNA repair protein RecN (Protein is coded in complementary strand; from 623357 to 621549)