Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 4449096
End position: 4449119
Length: 24

DNA sequence
>NC_019689, from 4449096 to 4449119 (24 bp); Pleurocapsa sp. PCC 7327 CTTCGTCTTCGCCTTCTTCTTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4449038-4449859	Sequence	Ple7327_4166 - ribosomal protein S2 (Protein is coded in complementary strand; from 4449859 to 4449038)