Sequence retrieval

Genome: Pleurocapsa sp. PCC 7327
Start position: 2950595
End position: 2950618
Length: 24

DNA sequence
>NC_019689, from 2950595 to 2950618 (24 bp); Pleurocapsa sp. PCC 7327 CCGTTGCCGTTGCCATTGCCGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2950070-2950657	Sequence	Ple7327_2743 - phosphonate C-P lyase system protein PhnG (Protein is coded in complementary strand; from 2950657 to 2950070)