Sequence retrieval

Genome: Thalassobaculum sp. L2
Start position: 352273
End position: 352296
Length: 24

DNA sequence
>NC_019566, from 352273 to 352296 (24 bp); Thalassobaculum sp. L2 ATGGCTATGGCTATGGCTATGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 351466-352854	Sequence	A1OE_384 sun ribosomal RNA small subunit methyltransferase B (Protein is coded in complementary strand; from 352854 to 351466)