Sequence retrieval

Genome: Thalassobaculum sp. L2
Start position: 209158
End position: 209187
Length: 30

DNA sequence
>NC_019566, from 209158 to 209187 (30 bp); Thalassobaculum sp. L2 ATCGACGTCAGTCGACGTAAATCGCCTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 209017-209400	Sequence	A1OE_213 rpsM Ribosomal protein S13 (Protein is coded in complementary strand; from 209400 to 209017)