Sequence retrieval

Genome: Thalassobaculum sp. L2
Start position: 1353996
End position: 1354025
Length: 30

DNA sequence
>NC_019566, from 1353996 to 1354025 (30 bp); Thalassobaculum sp. L2 TAAATTTAAGTTTAAATTTTAATTTAATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1354025-1354168	Sequence	A1OE_1473 - hypothetical protein (Protein is coded in complementary strand; from 1354168 to 1354025)