Sequence retrieval

Genome: Listeria monocytogenes serotype 4b str. LL195
Start position: 957205
End position: 957228
Length: 24

DNA sequence
>NC_019556, from 957205 to 957228 (24 bp); Listeria monocytogenes serotype 4b str. LL195 AGAACAAAAACAACAACAAGAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 956715-958286	Sequence	BN389_09500 msrA Erythromycin resistance ATP-binding protein MsrA