Sequence retrieval

Genome: Listeria monocytogenes serotype 4b str. LL195
Start position: 724772
End position: 724811
Length: 40

DNA sequence
>NC_019556, from 724772 to 724811 (40 bp); Listeria monocytogenes serotype 4b str. LL195 TTTTTTCTTTTTTTGTATTTTTTTGTGTTTTTCTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 724309-725229	Sequence	BN389_07200 mogR Motility gene repressor mogR (Protein is coded in complementary strand; from 725229 to 724309)