Sequence retrieval

Genome: Listeria monocytogenes serotype 4b str. LL195
Start position: 701912
End position: 701938
Length: 27

DNA sequence
>NC_019556, from 701912 to 701938 (27 bp); Listeria monocytogenes serotype 4b str. LL195 TTCAGGAGCCTCAGGAGCCTCAGGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 701829-702857	Sequence	BN389_06920 - hypothetical protein (Protein is coded in complementary strand; from 702857 to 701829)