Sequence retrieval

Genome: Listeria monocytogenes serotype 4b str. LL195
Start position: 675414
End position: 675449
Length: 36

DNA sequence
>NC_019556, from 675414 to 675449 (36 bp); Listeria monocytogenes serotype 4b str. LL195 ACACCAAAAGATACACCAAAAAATACACCAAAAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 670825-675585	Sequence	BN389_06640 - Cell wall surface anchor family protein