Sequence retrieval

Genome: Listeria monocytogenes serotype 4b str. LL195
Start position: 625965
End position: 625988
Length: 24

DNA sequence
>NC_019556, from 625965 to 625988 (24 bp); Listeria monocytogenes serotype 4b str. LL195 TTTGTATTAGTATTGGTATTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 625545-627170	Sequence	BN389_06190 iap Probable endopeptidase p60 (Protein is coded in complementary strand; from 627170 to 625545)