Sequence retrieval

Genome: Listeria monocytogenes serotype 4b str. LL195
Start position: 557255
End position: 557281
Length: 27

DNA sequence
>NC_019556, from 557255 to 557281 (27 bp); Listeria monocytogenes serotype 4b str. LL195 AGAAAAAGCAGATAAAGCAGAAAAAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 555574-557403	Sequence	BN389_05520 - Cell wall surface anchor family protein