Sequence retrieval

Genome: Listeria monocytogenes serotype 4b str. LL195
Start position: 357973
End position: 358008
Length: 36

DNA sequence
>NC_019556, from 357973 to 358008 (36 bp); Listeria monocytogenes serotype 4b str. LL195 TTGCTTGTTTTGTTGCTTGTTTTGTTGCTGTTTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 357849-359105	Sequence	BN389_03410 - Cell wall surface anchor family protein (Protein is coded in complementary strand; from 359105 to 357849)