Sequence retrieval

Genome: Listeria monocytogenes serotype 4b str. LL195
Start position: 2709136
End position: 2709159
Length: 24

DNA sequence
>NC_019556, from 2709136 to 2709159 (24 bp); Listeria monocytogenes serotype 4b str. LL195 CAACAACACCAATAACAAAAACAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2708349-2710034	Sequence	BN389_26480 kdpA Potassium-transporting ATPase A chain (Protein is coded in complementary strand; from 2710034 to 2708349)