Sequence retrieval

Genome: Listeria monocytogenes serotype 4b str. LL195
Start position: 2682540
End position: 2682572
Length: 33

DNA sequence
>NC_019556, from 2682540 to 2682572 (33 bp); Listeria monocytogenes serotype 4b str. LL195 TTTGCTTTTGATTTGTTTTTTATTTACTTTTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2681776-2683173	Sequence	BN389_26220 dgt Deoxyguanosinetriphosphate triphosphohydrolase-like protein (Protein is coded in complementary strand; from 2683173 to 2681776)