Sequence retrieval

Genome: Listeria monocytogenes serotype 4b str. LL195
Start position: 2406609
End position: 2406653
Length: 45

DNA sequence
>NC_019556, from 2406609 to 2406653 (45 bp); Listeria monocytogenes serotype 4b str. LL195 ATTTTGTTGAATCTAATTTTGTTGAATCTAGTTTTGTTGAATCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2405288-2406709	Sequence	BN389_23410 - hypothetical protein (Protein is coded in complementary strand; from 2406709 to 2405288)