Sequence retrieval

Genome: Listeria monocytogenes serotype 4b str. LL195
Start position: 2370459
End position: 2370488
Length: 30

DNA sequence
>NC_019556, from 2370459 to 2370488 (30 bp); Listeria monocytogenes serotype 4b str. LL195 CTTTTTCATCCTTTTTCCCCCTTTTTTATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2369659-2370519	Sequence	BN389_23150 tcyK L-cystine-binding protein tcyK (Protein is coded in complementary strand; from 2370519 to 2369659)
ORF... 2370485-2371021	Sequence	BN389_23160 ytmI Uncharacterized N-acetyltransferase YtmI (Protein is coded in complementary strand; from 2371021 to 2370485)