Sequence retrieval

Genome: Listeria monocytogenes serotype 4b str. LL195
Start position: 2362770
End position: 2362793
Length: 24

DNA sequence
>NC_019556, from 2362770 to 2362793 (24 bp); Listeria monocytogenes serotype 4b str. LL195 TTGCTTTTCCTTCTGCTTTTGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2361920-2362870	Sequence	BN389_23070 psuG Pseudouridine-5'-phosphate glycosidase (Protein is coded in complementary strand; from 2362870 to 2361920)