Sequence retrieval

Genome: Listeria monocytogenes serotype 4b str. LL195
Start position: 2082044
End position: 2082076
Length: 33

DNA sequence
>NC_019556, from 2082044 to 2082076 (33 bp); Listeria monocytogenes serotype 4b str. LL195 TTTGTTTAATGTTTCTTCAATGTTTGTAAAATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2081724-2082266	Sequence	BN389_20400 divIVA Septum site-determining protein DivIVA (Protein is coded in complementary strand; from 2082266 to 2081724)