Sequence retrieval

Genome: Listeria monocytogenes serotype 4b str. LL195
Start position: 1996629
End position: 1996688
Length: 60

DNA sequence
>NC_019556, from 1996629 to 1996688 (60 bp); Listeria monocytogenes serotype 4b str. LL195 TCAGCTTTTTCAGCAGCAGCTTTCTCGGCAGCAGCTTTCTCGGCAGCAGCTTTGTCAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1996431-1997165	Sequence	BN389_19660 - LysM domain-containing protein (Protein is coded in complementary strand; from 1997165 to 1996431)