Sequence retrieval

Genome: Listeria monocytogenes serotype 4b str. LL195
Start position: 196958
End position: 196981
Length: 24

DNA sequence
>NC_019556, from 196958 to 196981 (24 bp); Listeria monocytogenes serotype 4b str. LL195 CGTCATCATCATCGTCATCATCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 196049-197275	Sequence	BN389_01990 yabE Uncharacterized protein yabE