Sequence retrieval

Genome: Listeria monocytogenes serotype 4b str. LL195
Start position: 1850168
End position: 1850215
Length: 48

DNA sequence
>NC_019556, from 1850168 to 1850215 (48 bp); Listeria monocytogenes serotype 4b str. LL195 GCATCAGCATCAGCATCAGCATCAGCATCAGCATCAGCATCAGCATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1849211-1851253	Sequence	BN389_18260 - hypothetical protein (Protein is coded in complementary strand; from 1851253 to 1849211)