Sequence retrieval

Genome: Listeria monocytogenes serotype 4b str. LL195
Start position: 168408
End position: 168452
Length: 45

DNA sequence
>NC_019556, from 168408 to 168452 (45 bp); Listeria monocytogenes serotype 4b str. LL195 AGTACCGCCAACACCAGTACCACCAACACCAATACCGCCTACTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 166601-168670	Sequence	BN389_01760 wapA Wall-associated protein