Sequence retrieval

Genome: Listeria monocytogenes serotype 4b str. LL195
Start position: 1624217
End position: 1624252
Length: 36

DNA sequence
>NC_019556, from 1624217 to 1624252 (36 bp); Listeria monocytogenes serotype 4b str. LL195 GCTGCTTCTTTTGCTGCTTCTTTCGCTGCTTTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1624199-1624654	Sequence	BN389_16260 - UPF0478 protein SAOUHSC_01855 (Protein is coded in complementary strand; from 1624654 to 1624199)