Sequence retrieval

Genome: Listeria monocytogenes serotype 4b str. LL195
Start position: 1384420
End position: 1384444
Length: 25

DNA sequence
>NC_019556, from 1384420 to 1384444 (25 bp); Listeria monocytogenes serotype 4b str. LL195 TTTTTTTTATTTTTCTTTCTTTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1384427-1385254	Sequence	BN389_14040 yidC2 Membrane protein insertase YidC 2 (Protein is coded in complementary strand; from 1385254 to 1384427)