Sequence retrieval

Genome: Listeria monocytogenes serotype 4b str. LL195
Start position: 1113453
End position: 1113477
Length: 25

DNA sequence
>NC_019556, from 1113453 to 1113477 (25 bp); Listeria monocytogenes serotype 4b str. LL195 TTTTTTTATTTTTTATCTTTTTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1113459-1114367	Sequence	BN389_11120 cap4C UTP--glucose-1-phosphate uridylyltransferase (Protein is coded in complementary strand; from 1114367 to 1113459)