Sequence retrieval

Genome: Methanolobus psychrophilus R15
Start position: 2843124
End position: 2843186
Length: 63

DNA sequence
>NC_018876, from 2843124 to 2843186 (63 bp); Methanolobus psychrophilus R15 GTTATCATTGTCGTCGTCCCGGTTATCGTTATCGTCATCCCTGTCATCAAAGTCATCGTCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2843038-2844357	Sequence	Mpsy_2976 - cell surface protein (Protein is coded in complementary strand; from 2844357 to 2843038)