Sequence retrieval

Genome: Methanolobus psychrophilus R15
Start position: 1098961
End position: 1099023
Length: 63

DNA sequence
>NC_018876, from 1098961 to 1099023 (63 bp); Methanolobus psychrophilus R15 TAGAAGATGACGACCCATCGTCAGAAGATGACGACTCATCGTCAGAAGATGACGACCCATCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1098480-1099094	Sequence	Mpsy_1099 - hypothetical protein (Protein is coded in complementary strand; from 1099094 to 1098480)